fetching SNP data from GVF file for primer sequences with BLAST input?

so I am trying to fetch SNP data (MAF, rsNumbers, Alternate and reference allele) from this file:

1000GENOMES-phase_3.gvf

this is how my input looks like:

Plain text
Copy to clipboard
Open code in new window
EnlighterJS 3 Syntax Highlighter
<code>Primer_0|CYP2C19 NC_000010.11 100.000 23 0 0 1 23 94781749 94781771 2.65e-04 46.1 23 CCAGAGCTTGGCATATTATCT Within specified genomic region
</code>
<code>Primer_0|CYP2C19 NC_000010.11 100.000 23 0 0 1 23 94781749 94781771 2.65e-04 46.1 23 CCAGAGCTTGGCATATTATCT Within specified genomic region </code>
Primer_0|CYP2C19    NC_000010.11    100.000 23  0   0   1   23  94781749    94781771    2.65e-04    46.1    23 CCAGAGCTTGGCATATTATCT Within specified genomic region

and this is the code snippet that is supposed to do this Job:

Plain text
Copy to clipboard
Open code in new window
EnlighterJS 3 Syntax Highlighter
<code>def fetch_snps_for_primer(chrom, start, end, sequence, gvf_file):
"""Fetch SNPs from the compressed GVF file by processing it line by line in Python."""
results = []
# Open the compressed GVF file using gzip
with gzip.open(gvf_file, 'rt') as gvf: # 'rt' means read text mode
for line in gvf:
if line.startswith("#"): # Skip header lines
continue
parts = line.strip().split("t")
if len(parts) < 9:
continue # Skip malformed lines
chrom_gvf = parts[0]
pos_start = int(parts[3]) # SNP start position
info_field = parts[8]
# Check if this SNP is in the current primer region
if chrom_gvf == chrom and start <= pos_start <= end:
snp_id = None
ref = None
alts = []
# Extract SNP ID, reference, and variant sequences
for field in info_field.split(";"):
if field.startswith("Dbxref=dbSNP_"):
snp_id = field.split(":")[1] # Extract rsID from Dbxref
elif field.startswith("Reference_seq="):
ref = field.split("=")[1]
elif field.startswith("Variant_seq="):
alts = field.split("=")[1].split(",")
if snp_id:
results.append({
'Chromosome': chrom_gvf,
'Start': pos_start,
'End': pos_start, # SNPs typically are a single base
'Primer Sequence': sequence,
'SNP ID': snp_id,
'Reference Allele': ref,
'Alternate Alleles': ','.join(alts)
})
return results
</code>
<code>def fetch_snps_for_primer(chrom, start, end, sequence, gvf_file): """Fetch SNPs from the compressed GVF file by processing it line by line in Python.""" results = [] # Open the compressed GVF file using gzip with gzip.open(gvf_file, 'rt') as gvf: # 'rt' means read text mode for line in gvf: if line.startswith("#"): # Skip header lines continue parts = line.strip().split("t") if len(parts) < 9: continue # Skip malformed lines chrom_gvf = parts[0] pos_start = int(parts[3]) # SNP start position info_field = parts[8] # Check if this SNP is in the current primer region if chrom_gvf == chrom and start <= pos_start <= end: snp_id = None ref = None alts = [] # Extract SNP ID, reference, and variant sequences for field in info_field.split(";"): if field.startswith("Dbxref=dbSNP_"): snp_id = field.split(":")[1] # Extract rsID from Dbxref elif field.startswith("Reference_seq="): ref = field.split("=")[1] elif field.startswith("Variant_seq="): alts = field.split("=")[1].split(",") if snp_id: results.append({ 'Chromosome': chrom_gvf, 'Start': pos_start, 'End': pos_start, # SNPs typically are a single base 'Primer Sequence': sequence, 'SNP ID': snp_id, 'Reference Allele': ref, 'Alternate Alleles': ','.join(alts) }) return results </code>
def fetch_snps_for_primer(chrom, start, end, sequence, gvf_file):
    """Fetch SNPs from the compressed GVF file by processing it line by line in Python."""
    results = []
    
    # Open the compressed GVF file using gzip
    with gzip.open(gvf_file, 'rt') as gvf:  # 'rt' means read text mode
        for line in gvf:
            if line.startswith("#"):  # Skip header lines
                continue
            
            parts = line.strip().split("t")
            if len(parts) < 9:
                continue  # Skip malformed lines
            
            chrom_gvf = parts[0]
            pos_start = int(parts[3])  # SNP start position
            info_field = parts[8]

            # Check if this SNP is in the current primer region
            if chrom_gvf == chrom and start <= pos_start <= end:
                snp_id = None
                ref = None
                alts = []

                # Extract SNP ID, reference, and variant sequences
                for field in info_field.split(";"):
                    if field.startswith("Dbxref=dbSNP_"):
                        snp_id = field.split(":")[1]  # Extract rsID from Dbxref
                    elif field.startswith("Reference_seq="):
                        ref = field.split("=")[1]
                    elif field.startswith("Variant_seq="):
                        alts = field.split("=")[1].split(",")

                if snp_id:
                    results.append({
                        'Chromosome': chrom_gvf,
                        'Start': pos_start,
                        'End': pos_start,  # SNPs typically are a single base
                        'Primer Sequence': sequence,
                        'SNP ID': snp_id,
                        'Reference Allele': ref,
                        'Alternate Alleles': ','.join(alts)
                    })

    return results

note: i have 29 different primer sequences and all should have SNPs inside their range, but it only finds SNPs for 20 of them.
However, when I try to fetch the data via the command line for the primer sequences that have no SNPs after running the script, it finds data.

It would be so amazing if somebody could me!
Thanks already in advance 🙂

I tried to change the code in many different ways, but no matter what I did data was not found for all primer sequences.
I expect SNP data for all primer sequences.

Trang chủ Giới thiệu Sinh nhật bé trai Sinh nhật bé gái Tổ chức sự kiện Biểu diễn giải trí Dịch vụ khác Trang trí tiệc cưới Tổ chức khai trương Tư vấn dịch vụ Thư viện ảnh Tin tức - sự kiện Liên hệ Chú hề sinh nhật Trang trí YEAR END PARTY công ty Trang trí tất niên cuối năm Trang trí tất niên xu hướng mới nhất Trang trí sinh nhật bé trai Hải Đăng Trang trí sinh nhật bé Khánh Vân Trang trí sinh nhật Bích Ngân Trang trí sinh nhật bé Thanh Trang Thuê ông già Noel phát quà Biểu diễn xiếc khỉ Xiếc quay đĩa Dịch vụ tổ chức sự kiện 5 sao Thông tin về chúng tôi Dịch vụ sinh nhật bé trai Dịch vụ sinh nhật bé gái Sự kiện trọn gói Các tiết mục giải trí Dịch vụ bổ trợ Tiệc cưới sang trọng Dịch vụ khai trương Tư vấn tổ chức sự kiện Hình ảnh sự kiện Cập nhật tin tức Liên hệ ngay Thuê chú hề chuyên nghiệp Tiệc tất niên cho công ty Trang trí tiệc cuối năm Tiệc tất niên độc đáo Sinh nhật bé Hải Đăng Sinh nhật đáng yêu bé Khánh Vân Sinh nhật sang trọng Bích Ngân Tiệc sinh nhật bé Thanh Trang Dịch vụ ông già Noel Xiếc thú vui nhộn Biểu diễn xiếc quay đĩa Dịch vụ tổ chức tiệc uy tín Khám phá dịch vụ của chúng tôi Tiệc sinh nhật cho bé trai Trang trí tiệc cho bé gái Gói sự kiện chuyên nghiệp Chương trình giải trí hấp dẫn Dịch vụ hỗ trợ sự kiện Trang trí tiệc cưới đẹp Khởi đầu thành công với khai trương Chuyên gia tư vấn sự kiện Xem ảnh các sự kiện đẹp Tin mới về sự kiện Kết nối với đội ngũ chuyên gia Chú hề vui nhộn cho tiệc sinh nhật Ý tưởng tiệc cuối năm Tất niên độc đáo Trang trí tiệc hiện đại Tổ chức sinh nhật cho Hải Đăng Sinh nhật độc quyền Khánh Vân Phong cách tiệc Bích Ngân Trang trí tiệc bé Thanh Trang Thuê dịch vụ ông già Noel chuyên nghiệp Xem xiếc khỉ đặc sắc Xiếc quay đĩa thú vị
Trang chủ Giới thiệu Sinh nhật bé trai Sinh nhật bé gái Tổ chức sự kiện Biểu diễn giải trí Dịch vụ khác Trang trí tiệc cưới Tổ chức khai trương Tư vấn dịch vụ Thư viện ảnh Tin tức - sự kiện Liên hệ Chú hề sinh nhật Trang trí YEAR END PARTY công ty Trang trí tất niên cuối năm Trang trí tất niên xu hướng mới nhất Trang trí sinh nhật bé trai Hải Đăng Trang trí sinh nhật bé Khánh Vân Trang trí sinh nhật Bích Ngân Trang trí sinh nhật bé Thanh Trang Thuê ông già Noel phát quà Biểu diễn xiếc khỉ Xiếc quay đĩa
Thiết kế website Thiết kế website Thiết kế website Cách kháng tài khoản quảng cáo Mua bán Fanpage Facebook Dịch vụ SEO Tổ chức sinh nhật