so I am trying to fetch SNP data (MAF, rsNumbers, Alternate and reference allele) from this file:

1000GENOMES-phase_3.gvf

this is how my input looks like:

Primer_0|CYP2C19    NC_000010.11    100.000 23  0   0   1   23  94781749    94781771    2.65e-04    46.1    23 CCAGAGCTTGGCATATTATCT Within specified genomic region

and this is the code snippet that is supposed to do this Job:

def fetch_snps_for_primer(chrom, start, end, sequence, gvf_file):
    """Fetch SNPs from the compressed GVF file by processing it line by line in Python."""
    results = []
    
    # Open the compressed GVF file using gzip
    with gzip.open(gvf_file, 'rt') as gvf:  # 'rt' means read text mode
        for line in gvf:
            if line.startswith("#"):  # Skip header lines
                continue
            
            parts = line.strip().split("t")
            if len(parts) < 9:
                continue  # Skip malformed lines
            
            chrom_gvf = parts[0]
            pos_start = int(parts[3])  # SNP start position
            info_field = parts[8]

            # Check if this SNP is in the current primer region
            if chrom_gvf == chrom and start <= pos_start <= end:
                snp_id = None
                ref = None
                alts = []

                # Extract SNP ID, reference, and variant sequences
                for field in info_field.split(";"):
                    if field.startswith("Dbxref=dbSNP_"):
                        snp_id = field.split(":")[1]  # Extract rsID from Dbxref
                    elif field.startswith("Reference_seq="):
                        ref = field.split("=")[1]
                    elif field.startswith("Variant_seq="):
                        alts = field.split("=")[1].split(",")

                if snp_id:
                    results.append({
                        'Chromosome': chrom_gvf,
                        'Start': pos_start,
                        'End': pos_start,  # SNPs typically are a single base
                        'Primer Sequence': sequence,
                        'SNP ID': snp_id,
                        'Reference Allele': ref,
                        'Alternate Alleles': ','.join(alts)
                    })

    return results

note: i have 29 different primer sequences and all should have SNPs inside their range, but it only finds SNPs for 20 of them.
However, when I try to fetch the data via the command line for the primer sequences that have no SNPs after running the script, it finds data.

It would be so amazing if somebody could me!
Thanks already in advance 🙂

I tried to change the code in many different ways, but no matter what I did data was not found for all primer sequences.
I expect SNP data for all primer sequences.