I have the following bash script that randomly subsamples a zipped FASTA file based on specifying the number of DNA sequences to sample num_sequences. However, the code is buggy. (1) It returns more than num_sequences sequences and (2) the FASTA headers are corrupt.

#!/bin/bash

# Check if input arguments are provided
if [ $# -ne 3 ]; then
   echo "Usage: $0 input_file output_file num_sequences"
   exit 1
fi

# Input arguments
input_file=$1
output_file=$2
num_sequences=$3

# Check if input file exists
if [ ! -f "$input_file" ]; then
    echo "Input file not found: $input_file"
    exit 1
fi

# Check if num_sequences is a positive integer
if ! [[ $num_sequences =~ ^[0-9]+$ ]]; then
    echo "Invalid number of sequences: $num_sequences"
    exit 1
fi

# Downsizing the FASTA file
echo "Downsizing $input_file to $output_file by randomly selecting $num_sequences sequences..."

# Determine unzip command based on input file type
if [[ "$input_file" == *.gz ]]; then
    unzip_command="zcat"
else
    unzip_command="cat"
fi

 # Count the total number of sequences in the input file
 total_sequences=$($unzip_command "$input_file" | grep -c "^>")

 # Check if the requested number of sequences is greater than the total number of sequences
 if [ "$num_sequences" -gt "$total_sequences" ]; then
     echo "Requested number of sequences exceeds total number of sequences in input    file."
 exit 1
 fi

 # Generate a random sample of sequence indices using awk and extract sequences
 $unzip_command "$input_file" | awk -v max="$total_sequences" -v n="$num_sequences"  '
     BEGIN {
         srand();   # Initialize random number generator
         RS = "n>"; # Set record separator to FASTA header format
     }
     NR > 1 {      # Skip first empty record
         seq_index = 1 + int(rand() * max); # Generate random sequence index
         if (seq_index in selected || length(selected) < n) { # Select sequences
             print ">" $0; # Output the complete FASTA record
             selected[seq_index] = 1; # Mark this sequence index as selected
         }
     }
 ' | $unzip_command > "$output_file"

 echo "Downsizing complete. Output saved to $output_file"

The output looks like (only first sequence show for brevity):

>090135ec-5580-4402-89a6-dcaa0e42b9a9
AAGGTTAACCTGGTAACTAGGACACAAGACTCCAGCACCTGGTAGTACTCACTGCGCTCACTAAACTTCTGGATGTCCAAAAAATCAAAATAAGTGTTGGTATAAAATTGGGTCTCCTCCTCCAGCTGGGTCAAAAAAAGATGTATTTAAATTTCGATCAGTTAAAAGTATTGTAATAGCTCCTGCTAAAACTGGAAGGGATAGAAGAAGAAGGAATGCAGTAATTATAACTGATCATACAAATAATGGTATTCGATCATAGAGAATAGCTCGTATATTAATAATAGTTGTAATAAAATTTACTGCACCTAAAATTGATGAAATTCCTGCTAAATGAAGAGAAAAAATAGCTAAATCTACAGATGCTCCTCTATGAGCAATTACTGAAGAAAGAGGTGGGTATACTGTTCATCCTGTTCCAGCTCCATTATTAACTATACTTCTAACAAGGAGAAGGGTTAAAGATGGAGGTAAAAGTCAAAATCTTATATTATTTATTCGTGGGAATGCTATATCGGGAGCTCCTAATATTAATGGAACTAATCAATTTCCAAATCCCCCAATTATTATTGGTATAACTATAAAAAAAATTATAATAAAAGCATGTGCTGTTACAATTACATTATAAATTTGATCATCTCCAATTAAAGATCCTGGGTGTCCAAGTTCTCTTCGAATTAAAATTCTTAAAGAGGTTCCAACTATTCCTGCTCATGCTCCGAAAATAAAATATAATGTACCAATATCTTTATGATTGGTTGACTACACACGTGTCATGCGCTACCAGGTGCTGGAGTCTTGTGTCCCAGTTACCAGGTTACA

Any ideas on what might be causing this and how to fix it?