Sequence color blocks inside ggplot2 plot area at specific coordinates

I have a simple line plot where I show a DNA sequence on the x-axis, done in the following way with ggplot2:

myseq <- "AGAATATTATACATTCATCT"
set.seed(123)
mydata <- data.frame(time=1:100, value=rnorm(100, mean=10, sd=2))
indices <- seq(5, 100, length.out=20)
seqsplit <- unlist(strsplit(myseq, ""))
ind_df <- data.frame(call=seqsplit, time=indices)
final_df <- dplyr::left_join(mydata, ind_df, by="time")
xcolors <- ifelse(seqsplit=="A", "green", ifelse(seqsplit=="C", "blue", ifelse(seqsplit=="G", "black", "red")))
P <- ggplot2::ggplot(final_df, ggplot2::aes(x=time, y=value)) +
  ggplot2::geom_line(linewidth=0.5) +
  ggplot2::scale_x_continuous(breaks=indices, labels=seqsplit) +
  ggplot2::scale_y_continuous(limits=c(5,17)) +
  ggplot2::theme_light() +
  ggplot2::theme(axis.title.x=ggplot2::element_blank(),
                 axis.text.x=ggtext::element_markdown(face="bold", color=xcolors))
grDevices::pdf(file="test.pdf", height=3, width=10)
print(P)
grDevices::dev.off()

which produces:

Now I have an associated aminoacid sequence of length 4, for which I know the start and end positions in the DNA sequence. Each letter of the aminoacid sequence corresponds to 3 letters in the DNA sequence.

aaseq <- "WXYZ"
start <- 5
end <- 17

Here the aminoacid sequence WXYZ starts on T-5 and ends on C-17 of the DNA sequence above, and I want to plot them together.

This would be my ultimate goal (it could be just squares instead of “arrows”):

Is there an easy way to accomplish this in ggplot2?

An easy option without the arrows would be to use a geom_segment:

geom_segment(
  data = df_arrows,
  aes(x = x, xend = xend, y = 16, yend = 16, color = I(color)),
  linewidth = 8
)

But if you want the arrows then I would suggest to go for geom_polygon which however requires some effort to create a dataframe with the coordinates for the polygon:

library(ggplot2)
library(dplyr)

aaseq <- "WXYZ"
start <- 5
end <- 17

df_arrows <- data.frame(
  x = indices[seq(start, end - 3, 3)],
  xend = indices[seq(start + 3, end, 3)],
  y = 16, yend = 16,
  color = c("blue", "green", "orange", "purple"),
  label = strsplit(aaseq, "")[[1]]
)

df_polygon <- df_arrows |>
  dplyr::mutate(label = factor(label, rev(unique(label)))) |>
  dplyr::reframe(
    data.frame(
      x = c(x, xend, xend, xend, x) + c(0, 0, 4, 0, 0),
      y = y + .5 * c(1, 1, 0, -1, -1),
      color = color,
      label = label
    ),
    .by = label
  )

ggplot(final_df, aes(x = time, y = value)) +
  scale_x_continuous(breaks = indices, labels = seqsplit) +
  scale_y_continuous(limits = c(5, 17)) +
  theme_light() +
  theme(
    axis.title.x = element_blank(),
    axis.text.x = ggtext::element_markdown(face = "bold", color = xcolors)
  ) +
  annotate(
    "rect",
    xmin = indices[start], xmax = indices[end],
    ymin = -Inf, ymax = Inf,
    fill = "grey", alpha = .4
  ) +
  geom_polygon(
    data = df_polygon,
    aes(x = x, y = y, fill = I(color), group = label)
  ) +
  geom_text(
    data = df_arrows,
    aes(x = (x + xend) / 2 + 1, y = y, label = label),
    color = "white", fontface = "bold"
  ) +
  geom_line(linewidth = 0.5)

Recognized by R Language Collective

4

Based on @stefan answer, I figured I still wanted the arrow direction, but the polygon got so complicated with my real data…

This would go into a Shiny app that takes in different data as input, and the y values can vary a lot, so defining polygon could become a mess.

I played around with the arrow argument of geom_segment, but I did not get what I wanted. However, simply plotting geom_point at xend with the diamond shape and a size equal to the linewidth in geom_segment does the perfect trick in a very simple way.

myseq <- "AGAATATTATACATTCATCT"
set.seed(123)
mydata <- data.frame(time=1:100, value=rnorm(100, mean=10, sd=2))
indexes <- seq(5, 100, length.out=20)
seqsplit <- unlist(strsplit(myseq, ""))
ind_df <- data.frame(call=seqsplit, time=indexes)
final_df <- dplyr::left_join(mydata, ind_df, by="time")
xcolors <- ifelse(seqsplit=="A", "green", ifelse(seqsplit=="C", "blue", ifelse(seqsplit=="G", "black", "red")))
#
#aa sequence
aaseq <- "WXYZ"
start <- 5
end <- 17
df_arrows <- data.frame(x=indexes[seq(start, end-3, 3)] -2.5,
                        xend=indexes[seq(start+3, end, 3)] -2.5,
                        y=16, yend=16,
                        color=c("blue", "green", "orange", "purple"),
                        label=strsplit(aaseq, "")[[1]])
##
P <- ggplot2::ggplot(final_df, ggplot2::aes(x=time, y=value)) +
  ggplot2::annotate("rect", xmin=indexes[start]-2.5, xmax=indexes[end]-2.5, ymin=-Inf, ymax=Inf, fill="grey", alpha=0.25) +
  ggplot2::geom_vline(data=df_arrows[-1,], ggplot2::aes(xintercept=x), color="grey", linetype=2, linewidth=0.5) +
  ggplot2::geom_line(linewidth=0.5) +
  ggplot2::scale_x_continuous(breaks=indexes, labels=seqsplit) +
  ggplot2::scale_y_continuous(limits=c(5,17)) +
  ggplot2::geom_segment(data=df_arrows, ggplot2::aes(x=x, xend=xend, y=16, yend=16, color=I(color)), linewidth=8) +
  ggplot2::geom_point(data=df_arrows, ggplot2::aes(x=xend, y=16, color=I(color)), shape=18, size=8) +
  ggplot2::geom_text(data=df_arrows, ggplot2::aes(x=(x+xend)/2+1, y=y, label=label), color="white", fontface="bold") +
  ggplot2::theme_light() +
  ggplot2::theme(axis.title.x=ggplot2::element_blank(),
                 axis.text.x=ggtext::element_markdown(face="bold", color=xcolors))
grDevices::pdf(file="test.pdf", height=3, width=10)
print(P)
grDevices::dev.off()

which produces:

Trang chủ Giới thiệu Sinh nhật bé trai Sinh nhật bé gái Tổ chức sự kiện Biểu diễn giải trí Dịch vụ khác Trang trí tiệc cưới Tổ chức khai trương Tư vấn dịch vụ Thư viện ảnh Tin tức - sự kiện Liên hệ Chú hề sinh nhật Trang trí YEAR END PARTY công ty Trang trí tất niên cuối năm Trang trí tất niên xu hướng mới nhất Trang trí sinh nhật bé trai Hải Đăng Trang trí sinh nhật bé Khánh Vân Trang trí sinh nhật Bích Ngân Trang trí sinh nhật bé Thanh Trang Thuê ông già Noel phát quà Biểu diễn xiếc khỉ Xiếc quay đĩa Dịch vụ tổ chức sự kiện 5 sao Thông tin về chúng tôi Dịch vụ sinh nhật bé trai Dịch vụ sinh nhật bé gái Sự kiện trọn gói Các tiết mục giải trí Dịch vụ bổ trợ Tiệc cưới sang trọng Dịch vụ khai trương Tư vấn tổ chức sự kiện Hình ảnh sự kiện Cập nhật tin tức Liên hệ ngay Thuê chú hề chuyên nghiệp Tiệc tất niên cho công ty Trang trí tiệc cuối năm Tiệc tất niên độc đáo Sinh nhật bé Hải Đăng Sinh nhật đáng yêu bé Khánh Vân Sinh nhật sang trọng Bích Ngân Tiệc sinh nhật bé Thanh Trang Dịch vụ ông già Noel Xiếc thú vui nhộn Biểu diễn xiếc quay đĩa Dịch vụ tổ chức tiệc uy tín Khám phá dịch vụ của chúng tôi Tiệc sinh nhật cho bé trai Trang trí tiệc cho bé gái Gói sự kiện chuyên nghiệp Chương trình giải trí hấp dẫn Dịch vụ hỗ trợ sự kiện Trang trí tiệc cưới đẹp Khởi đầu thành công với khai trương Chuyên gia tư vấn sự kiện Xem ảnh các sự kiện đẹp Tin mới về sự kiện Kết nối với đội ngũ chuyên gia Chú hề vui nhộn cho tiệc sinh nhật Ý tưởng tiệc cuối năm Tất niên độc đáo Trang trí tiệc hiện đại Tổ chức sinh nhật cho Hải Đăng Sinh nhật độc quyền Khánh Vân Phong cách tiệc Bích Ngân Trang trí tiệc bé Thanh Trang Thuê dịch vụ ông già Noel chuyên nghiệp Xem xiếc khỉ đặc sắc Xiếc quay đĩa thú vị
Trang chủ Giới thiệu Sinh nhật bé trai Sinh nhật bé gái Tổ chức sự kiện Biểu diễn giải trí Dịch vụ khác Trang trí tiệc cưới Tổ chức khai trương Tư vấn dịch vụ Thư viện ảnh Tin tức - sự kiện Liên hệ Chú hề sinh nhật Trang trí YEAR END PARTY công ty Trang trí tất niên cuối năm Trang trí tất niên xu hướng mới nhất Trang trí sinh nhật bé trai Hải Đăng Trang trí sinh nhật bé Khánh Vân Trang trí sinh nhật Bích Ngân Trang trí sinh nhật bé Thanh Trang Thuê ông già Noel phát quà Biểu diễn xiếc khỉ Xiếc quay đĩa
Thiết kế website Thiết kế website Thiết kế website Cách kháng tài khoản quảng cáo Mua bán Fanpage Facebook Dịch vụ SEO Tổ chức sinh nhật